miRBase entry: hsa-mir-21

Stem-loop hsa-mir-21


Accession
MI0000077
Symbol
HGNC: MIR21
Description
Homo sapiens hsa-mir-21 precursor miRNA mir-21
Gene
family?
RF00658; mir-21

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR21 is an oncogenic microRNA implicated in various cellular processes, including wound healing and cancer pathogenesis [PMC7053209, PMC5863695].'>PMC5863695].. In the context of non-small cell lung cancer (NSCLC), serum MIR21 levels are significantly elevated in patients compared to controls and are associated with advanced TNM stages [PMC4737022]. MIR21, along with CYFRA21-1, has been identified as a potential serum marker for the early diagnosis of NSCLC, with joint detection of these markers enhancing diagnostic efficiency [PMC4737022]. Moreover, MIR21 has been shown to confer resistance to heat shock protein 90 (HSP90) inhibitors in cancer cells by modulating the expression of HSP40 [PMC5863695]. Inhibition of MIR21 can restore sensitivity to HSP90 inhibitors, suggesting its potential as a biomarker for treatment response [PMC5863695]. Additionally, increased MIR21 abundance during oocyte maturation is associated with posttranscriptional regulation of programmed cell death 4 (PDCD4) expression and may affect embryonic development [PMC4833929]. Overall, these findings highlight the multifaceted role of MIR21 in disease processes and its utility as a biomarker for diagnosis and treatment response.

Literature search
4302 open access papers mention hsa-mir-21
(28577 sentences)

Sequence

73094434 reads, 49625.0 reads per million, 197 experiments
ugucgggUAGCUUAUCAGACUGAUGUUGACUguugaaucucauggCAACACCAGUCGAUGGGCUGUCUgaca
((((((((((((((((.(((((.(((((.((((.((...))))))))))).)))))))))))))))))))))

Structure
                A     A     A    u  a 
ugucgggUAGCUUAUC GACUG UGUUG CUgu ga  
|||||||||||||||| ||||| ||||| |||| || u
acagUCUGUCGGGUAG CUGAC ACAAC ggua cu  
                -     C     -    -  c 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 [2].

Genome context
chr17: 59841266-59841337 [+]

Disease association
hsa-mir-21 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-21 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-21 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-21-5p

Accession MIMAT0000076
Description Homo sapiens hsa-miR-21-5p mature miRNA
Sequence 8 - UAGCUUAUCAGACUGAUGUUGACU - 31
Evidence experimental
cloned [1-3,6-9], Northern [1,5], Illumina [10]
Database links
Predicted targets

Mature hsa-miR-21-3p

Accession MIMAT0004494
Description Homo sapiens hsa-miR-21-3p mature miRNA
Sequence 46 - CAACACCAGUCGAUGGGCUGUCU - 68
Evidence experimental
cloned [8-9]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  5. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  6. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  7. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  8. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  9. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  10. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854