miRBase entry: hsa-mir-24-2

Stem-loop hsa-mir-24-2


Accession
MI0000081
Symbol
HGNC: MIR24-2
Description
Homo sapiens hsa-mir-24-2 precursor miRNA mir-24
Gene
family?
RF00178; mir-24

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR24-2 is a microRNA implicated in the process of carcinogenesis, as evidenced by its interaction with the long non-coding RNA HULC, which is known to play a significant role in cancer development [PMC7575754]. In the context of bladder cancer (BLCA), research has demonstrated that there is a notable inverse correlation between the expression of COPZ1 and several microRNAs, including MIR24-2 [PMC10137353]. This suggests that MIR24-2 may be involved in regulatory pathways that influence COPZ1 expression, which could be significant given COPZ1's potential role in cancer biology.

Literature search
382 open access papers mention hsa-mir-24-2
(2261 sentences)

Sequence

2063366 reads, 2572.0 reads per million, 194 experiments
gcugccuggccucccugggcucugccucccGUGCCUACUGAGCUGAAACACAGUugguuuguguacacUGGCUCAGUUCAGCAGGAACAGgggucaagcccccuuggagccugcagcccc
(((((..(((.(((..(((((..(((.((.((.(((.(((((((((....((((.(.........)))))..))))))))).))).)).)))))..)))))....)))))).)))))...

Structure
---     cu   c   --cu     cu   u  c  G   A         AACA    u guu 
   gcugc  ggc ucc    gggcu  gcc cc GU CCU CUGAGCUGA    CAGU g   u
   |||||  ||| |||    |||||  ||| || || ||| |||||||||    |||| |   g
   cgacg  ccg agg    cccga  ugg gG CA GGA GACUUGACU    GUca c   u
ccc     -u   -   uucc     ac   -  A  A   C         --CG    - aug 


Annotation confidence High
Do you think this miRNA is real?
Comments
mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference [2].

Genome context
chr19: 13836287-13836359 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-24-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-24-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-24-2 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-24-2 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-24-2-5p

Accession MIMAT0004497
Description Homo sapiens hsa-miR-24-2-5p mature miRNA
Sequence 31 - GUGCCUACUGAGCUGAAACACAGU - 54
Evidence experimental
cloned [6]
Database links
Predicted targets

Mature hsa-miR-24-3p

Accession MIMAT0000080
Description Homo sapiens hsa-miR-24-3p mature miRNA
Sequence 69 - UGGCUCAGUUCAGCAGGAACAG - 90
Evidence experimental
cloned [1,4-7], Northern [1], Illumina [8]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  7. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  8. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854