Stem-loop hsa-mir-24-2

Accession

MI0000081

Symbol

HGNC: MIR24-2

Description

Homo sapiens hsa-mir-24-2 precursor miRNA mir-24

Gene
family

RF00178; mir-24

Literature search

382 open access papers mention hsa-mir-24-2
(2261 sentences)

Sequence

2063366 reads, 2572.0 reads per million, 194 experiments

gcugccuggccucccugggcucugccucccGUGCCUACUGAGCUGAAACACAGUugguuuguguacacUGGCUCAGUUCAGCAGGAACAGgggucaagcccccuuggagccugcagcccc
(((((..(((.(((..(((((..(((.((.((.(((.(((((((((....((((.(.........)))))..))))))))).))).)).)))))..)))))....)))))).)))))...

Structure

---     cu   c   --cu     cu   u  c  G   A         AACA    u guu 
   gcugc  ggc ucc    gggcu  gcc cc GU CCU CUGAGCUGA    CAGU g   u
   |||||  ||| |||    |||||  ||| || || ||| |||||||||    |||| |   g
   cgacg  ccg agg    cccga  ugg gG CA GGA GACUUGACU    GUca c   u
ccc     -u   -   uucc     ac   -  A  A   C         --CG    - aug 

Annotation confidence High

Comments

mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference [2].

Genome context

chr19: 13836287-13836359 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-24-2

Disease association

hsa-mir-24-2 is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-24-2 is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-24-2 is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-24-2-5p

• Accession: MIMAT0004497
• Description: Homo sapiens hsa-miR-24-2-5p mature miRNA
• Sequence: 31 - GUGCCUACUGAGCUGAAACACAGU - 54
• Evidence: experimental ; cloned [6]

Mature hsa-miR-24-3p

• Accession: MIMAT0000080
• Description: Homo sapiens hsa-miR-24-3p mature miRNA
• Sequence: 69 - UGGCUCAGUUCAGCAGGAACAG - 90
• Evidence: experimental ; cloned [1,4-7], Northern [1], Illumina [8]

References

1. PubMed ID: 11679670
   Identification of novel genes coding for small expressed RNAs
   "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
   "Science (2001) 294:853-858


2. PubMed ID: 14573789
   Reduced accumulation of specific microRNAs in colorectal neoplasia
   "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
   "Mol Cancer Res (2003) 1:882-891


3. PubMed ID: 15325244
   Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
   "Kasashima K, Nakamura Y, Kozu T"
   "Biochem Biophys Res Commun (2004) 322:403-410


4. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


5. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


6. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


7. PubMed ID: 11914277
   miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
   "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
   "Genes Dev (2002) 16:720-728


8. PubMed ID: 15978578
   Identification of human fetal liver miRNAs by a novel method
   "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
   "FEBS Lett (2005) 579:3849-3854