WARNING: This summary was generated by AI. MIR24-2 is a microRNA implicated in the process of carcinogenesis, as evidenced by its interaction with the long non-coding RNA HULC, which is known to play a significant role in cancer development [PMC7575754]. In the context of bladder cancer (BLCA), research has demonstrated that there is a notable inverse correlation between the expression of COPZ1 and several microRNAs, including MIR24-2 [PMC10137353]. This suggests that MIR24-2 may be involved in regulatory pathways that influence COPZ1 expression, which could be significant given COPZ1's potential role in cancer biology.
--- cu c --cu cu u c G A AACA u guu gcugc ggc ucc gggcu gcc cc GU CCU CUGAGCUGA CAGU g u ||||| ||| ||| ||||| ||| || || ||| ||||||||| |||| | g cgacg ccg agg cccga ugg gG CA GGA GACUUGACU GUca c u ccc -u - uucc ac - A A C --CG - aug
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004497 |
| Description | Homo sapiens hsa-miR-24-2-5p mature miRNA |
| Sequence | 31 - GUGCCUACUGAGCUGAAACACAGU - 54 |
| Evidence |
experimental
cloned [6] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000080 |
| Description | Homo sapiens hsa-miR-24-3p mature miRNA |
| Sequence | 69 - UGGCUCAGUUCAGCAGGAACAG - 90 |
| Evidence |
experimental
cloned [1,4-7], Northern [1], Illumina [8] |
| Database links |
|
| Predicted targets |
|
|