WARNING: This summary was generated by AI. MIR101-1 is a microRNA precursor that has been observed to significantly decrease in expression in certain brain regions when comparing long-term and acute responses to ischemic brain injury with immediate brain artery occlusion [PMC7848201]. This miRNA is also a part of the top-ranked miRNA expression signatures, indicating its potential role in the molecular response to ischemic events [PMC9284388]. In relation to immune response, MIR101-1 expression has been correlated with Th2 cell-related genes and is implicated in the regulation of immune cell function [PMC9380889]. Interestingly, MIR101-1 has a target sequence that can be extended by certain genetic variants, suggesting that genetic differences may influence its regulatory potential [PMC3198095]. Despite its regulatory capabilities, MIR101-1 does not target SUV39H2 mRNA according to predictions from TargetScan [PMC3198095]. In comparative studies of miRNA paralogues, MIR101-1 is distinguished from its paralogue MIR101-2 by uniquely aligned read pairs in small RNA-seq datasets, which emphasizes its unique presence and function [PMC6901076]. Moreover, MIR101-1 has been found notably down-regulated in patients with Parkinson's disease (PD), which may suggest a role for this miRNA in neurodegenerative processes [PMC5288660].
cuggc A gucua
ugcc UCAGUUAUCACAGUGCUG UGCU u
|||| |||||||||||||||||| ||||
acgg AGUCAAUAGUGUCAUGAC AUGg u
uaggA - aaauc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004513 |
| Description | Homo sapiens hsa-miR-101-5p mature miRNA |
| Sequence | 10 - UCAGUUAUCACAGUGCUGAUGCU - 32 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000099 |
| Description | Homo sapiens hsa-miR-101-3p mature miRNA |
| Sequence | 46 - GUACAGUACUGUGAUAACUGAA - 67 |
| Evidence |
experimental
cloned [1-4] |
| Database links |
|
| Predicted targets |
|
|