miRBase entry: hsa-mir-196a-2

Stem-loop hsa-mir-196a-2


Accession
MI0000279
Symbol
HGNC: MIR196A2
Description
Homo sapiens hsa-mir-196a-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR196A2 is a non-coding RNA involved in the regulation of genes associated with lower limb development and has been implicated in clinical conditions related to infertility and pain severity [PMC4041413]. Specifically, the rs11614913 C allele of MIR196A2 has been linked to an increased risk of infertility with a significance level of p=0.016, and it is also associated with heightened pain severity, as indicated by a p-value of 0.012 [PMC5363543]. Contrasting the effects observed with MIR196A2, SNP rs7372209 in MIR26A1 did not show an association with clinical symptoms, highlighting the unique role that genetic variations in MIR196A2 may play in these conditions [PMC5363543].

Literature search
251 open access papers mention hsa-mir-196a-2
(1312 sentences)

Sequence

209616 reads, 494.0 reads per million, 166 experiments
ugcucgcucagcugaucuguggcuUAGGUAGUUUCAUGUUGUUGGGauugaguuuugaacuCGGCAACAAGAAACUGCCUGAGuuacaucagucgguuuucgucgagggc
..(((((..(((((((.((((((((((((((((((.((((((((((.((........)))))))))))).))))))))))))))))))...)))))))...).))))...

Structure
-ug    - -uc       --c                  A          a  gag 
   cucg c   agcugau   uguggcuUAGGUAGUUUC UGUUGUUGGG uu   u
   |||| |   |||||||   |||||||||||||||||| |||||||||| ||    
   gagc g   uuggcug   acauuGAGUCCGUCAAAG ACAACGGCuc aa   u
cgg    u cuu       acu                  A          -  guu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. miR-196a was later validated in human [3,4]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr12: 53991738-53991847 [+]

Disease association
hsa-mir-196a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-196a-5p

Accession MIMAT0000226
Description Homo sapiens hsa-miR-196a-5p mature miRNA
Sequence 25 - UAGGUAGUUUCAUGUUGUUGGG - 46
Evidence experimental
cloned [3-5]
Database links
Predicted targets

Mature hsa-miR-196a-3p

Accession MIMAT0004562
Description Homo sapiens hsa-miR-196a-3p mature miRNA
Sequence 62 - CGGCAACAAGAAACUGCCUGAG - 83
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  4. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  5. PubMed ID: 15105502
    MicroRNA-directed cleavage of HOXB8 mRNA
    "Yekta S, Shih IH, Bartel DP"
    "Science (2004) 304:594-596