miRBase entry: hsa-let-7i

Stem-loop hsa-let-7i


Accession
MI0000434
Symbol
HGNC: MIRLET7I
Description
Homo sapiens hsa-let-7i precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIRLET7I is a microRNA implicated in various biological processes and diseases, including sepsis and cancer [PMC8358855]'>PMC8358855], [PMC6701281]. It is located in a CpG island, and the single nucleotide polymorphism (SNP) rs10877887 in its promoter region may affect its expression through epigenetic mechanisms [PMC9708458]. This SNP has a minor allele frequency of approximately 40%, indicating its common occurrence in the population [PMC9708458]. In sepsis patients, MIRLET7I levels are reduced in plasma, suggesting its potential as a biomarker for this condition [PMC8358855]. Additionally, MIRLET7I has been found to be downregulated in ovarian cancer patients and may serve as a discriminant between benign and malignant ovarian diseases [PMC6701281]. Bioinformatic analyses have shown that MIRLET7I targets genes related to cardiovascular development despite being less frequently expressed compared to other miRNAs [PMC7912193]. It is also found within extracellular vesicles (EVs), indicating its role in intercellular communication [PMC7912193]. Moreover, MIRLET7I dysregulation has been associated with various stages of HIV-1 infection and may interact with viral proteins to affect immune response and viral replication [PMC4761210].

Literature search
1093 open access papers mention hsa-let-7i
(6021 sentences)

Sequence

1571181 reads, 6607 reads per million, 138 experiments
cuggcUGAGGUAGUAGUUUGUGCUGUUggucggguugugacauugcccgcuguggagauaaCUGCGCAAGCUACUGCCUUGCUa
.((((.(((((((((((((((((.(((((.(((((.........)))))))........))).)))))))))))))))))))))

Structure
c    U                 U   --------  u     ugu 
 uggc GAGGUAGUAGUUUGUGC GUU        gg cgggu   g
 |||| ||||||||||||||||| |||        || |||||   a
 aUCG UUCCGUCAUCGAACGCG Caa        uc gcccg   c
-    -                 U   uagaggug  -     uua 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr12: 62603686-62603769 [+]

Disease association
hsa-let-7i is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7i-5p

Accession MIMAT0000415
Description Homo sapiens hsa-let-7i-5p mature miRNA
Sequence 6 - UGAGGUAGUAGUUUGUGCUGUU - 27
Evidence experimental
cloned [2-3], Illumina [5]
Database links
Predicted targets

Mature hsa-let-7i-3p

Accession MIMAT0004585
Description Homo sapiens hsa-let-7i-3p mature miRNA
Sequence 62 - CUGCGCAAGCUACUGCCUUGCU - 83
Evidence experimental
cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  4. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739