MIRLET7I is a microRNA that is downregulated in various diseases, including gastric cancer, ovarian cancer, sepsis, and HIV-1 infection [PMC9708458] [PMC6960189] [PMC8358855] [PMC6701281] [PMC4052096]. It is located in a CpG island and its expression can be regulated by epigenetic mechanisms [PMC9708458]. Two single nucleotide polymorphisms (SNPs), rs10877887 and rs13293512, are found in the promoter regions of MIRLET7I and the MIRLET7A1/MIRLET7F1/MIRLET7D cluster, respectively [PMC9708458]. Overexpression of MIRLET7I has been achieved using pCMV-MIR vectors in various cell lines [PMC6960189]. In sepsis patients, MIRLET7I expression is reduced compared to controls and has been proposed as a potential biomarker for sepsis diagnosis and prognosis [PMC8358855]. In ovarian cancer patients, MIRLET7I is significantly downregulated and can discriminate between benign and malignant ovarian disease [PMC6701281]. Bioinformatic analysis has shown that MIRLET7I targets genes related to cardiovascular development [PMC7912193]. In HIV-1 infection, dysregulation of MIRLET7I contributes to viral replication through DNA hypermethylation and immune system dysfunction. It also regulates the Vif/Vpr protein involved in immune response induction during the intermediate HIV infection stage. The high homology between MIRLET7I sequences and HIV-1 sequences supports its involvement in viral replication regulation during infection stages.
c U U -------- u ugu uggc GAGGUAGUAGUUUGUGC GUU gg cgggu g |||| ||||||||||||||||| ||| || ||||| a aUCG UUCCGUCAUCGAACGCG Caa uc gcccg c - - U uagaggug - uua
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000415 |
Description | Homo sapiens hsa-let-7i-5p mature miRNA |
Sequence | 6 - UGAGGUAGUAGUUUGUGCUGUU - 27 |
Evidence |
experimental
cloned [2-3], Illumina [5] |
Database links | |
Predicted targets |
Accession | MIMAT0004585 |
Description | Homo sapiens hsa-let-7i-3p mature miRNA |
Sequence | 62 - CUGCGCAAGCUACUGCCUUGCU - 83 |
Evidence |
experimental
cloned [2-4] |
Database links | |
Predicted targets |
|