miRBase entry: mmu-mir-103-2

Stem-loop mmu-mir-103-2


Accession
MI0000588
Symbol
MGI: Mir103-2
Description
Mus musculus mmu-mir-103-2 precursor miRNA mir-103
Gene
family?
RF00129; mir-103

Literature search
97 open access papers mention mmu-mir-103-2
(433 sentences)

Sequence

6144619 reads, 16710 reads per million, 107 experiments
gucuucgugcuuucAGCUUCUUUACAGUGCUGCCUUGuagcauucaggucaAGCAGCAUUGUACAGGGCUAUGAaagaaccaagaa
.((((.((.(((((((((.((.(((((((((((.(((.(.(.....).))))))))))))))).)))))..)))))).)).)))).

Structure
g    c  g      --   U  U           C   u g a 
 ucuu gu cuuucA  GCU CU UACAGUGCUGC UUG a c u
 |||| || ||||||  ||| || ||||||||||| ||| | | u
 agaa ca gaaAGU  CGG GA AUGUUACGACG Aac u g c
a    c  a      AU   -  C           -   - g a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2,3].

Genome context
chr2: 131288052-131288137 [+]

Database links

Mature mmu-miR-103-3p

Accession MIMAT0000546
Description Mus musculus mmu-miR-103-3p mature miRNA
Sequence 52 - AGCAGCAUUGUACAGGGCUAUGA - 74
Evidence experimental
cloned [2-4], Illumina [5,7]
Database links
Predicted targets

Mature mmu-miR-103-2-5p

Accession MIMAT0017025
Description Mus musculus mmu-miR-103-2-5p mature miRNA
Sequence 15 - AGCUUCUUUACAGUGCUGCCUUG - 37
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  7. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275