Stem-loop mmu-mir-107

Accession

MI0000684

Symbol

MGI: Mir107

Description

Mus musculus mmu-mir-107 precursor miRNA mir-103

Gene
family

RF00129; mir-103

Literature search

89 open access papers mention mmu-mir-107
(442 sentences)

Sequence

5318827 reads, 15027 reads per million, 107 experiments

uucucugugcuuucAGCUUCUUUACAGUGUUGCCUUGuggcauggaguucaAGCAGCAUUGUACAGGGCUAUCAaagcacagagagc
(((((((((((((.((((.((.(((((((((((.(((.(((.....))))))))))))))))).))))))...))))))))))))).

Structure

-             --c    U  U           C   u   a 
 uucucugugcuuu   AGCU CU UACAGUGUUGC UUG ggc u
 |||||||||||||   |||| || ||||||||||| ||| ||| g
 gagagacacgaaA   UCGG GA AUGUUACGACG Aac uug g
c             CUA    -  C           -   -   a 

Annotation confidence High

Comments

Mouse mir-107 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000114) [1], and later verified in mouse [3,4].

Genome context

chr19: 34820687-34820773 [-]

Mature mmu-miR-107-5p

• Accession: MIMAT0017048
• Description: Mus musculus mmu-miR-107-5p mature miRNA
• Sequence: 15 - AGCUUCUUUACAGUGUUGCCUUG - 37
• Evidence: experimental ; 454 [6], Illumina [7]

Mature mmu-miR-107-3p

• Accession: MIMAT0000647
• Description: Mus musculus mmu-miR-107-3p mature miRNA
• Sequence: 52 - AGCAGCAUUGUACAGGGCUAUCA - 74
• Evidence: experimental ; cloned [3-4], Illumina [5,7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 11914277
   miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
   "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
   "Genes Dev (2002) 16:720-728


3. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


7. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275