miRBase entry: mmu-mir-107

Stem-loop mmu-mir-107


Accession
MI0000684
Symbol
MGI: Mir107
Description
Mus musculus mmu-mir-107 precursor miRNA mir-103
Gene
family?
RF00129; mir-103

Literature search
89 open access papers mention mmu-mir-107
(442 sentences)

Sequence

5318827 reads, 14506 reads per million, 107 experiments
uucucugugcuuucAGCUUCUUUACAGUGUUGCCUUGuggcauggaguucaAGCAGCAUUGUACAGGGCUAUCAaagcacagagagc
(((((((((((((.((((.((.(((((((((((.(((.(((.....))))))))))))))))).))))))...))))))))))))).

Structure
-             --c    U  U           C   u   a 
 uucucugugcuuu   AGCU CU UACAGUGUUGC UUG ggc u
 |||||||||||||   |||| || ||||||||||| ||| ||| g
 gagagacacgaaA   UCGG GA AUGUUACGACG Aac uug g
c             CUA    -  C           -   -   a 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Mouse mir-107 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000114) [1], and later verified in mouse [3,4].

Genome context
chr19: 34820687-34820773 [-]

Database links

Mature mmu-miR-107-5p

Accession MIMAT0017048
Description Mus musculus mmu-miR-107-5p mature miRNA
Sequence 15 - AGCUUCUUUACAGUGUUGCCUUG - 37
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

Mature mmu-miR-107-3p

Accession MIMAT0000647
Description Mus musculus mmu-miR-107-3p mature miRNA
Sequence 52 - AGCAGCAUUGUACAGGGCUAUCA - 74
Evidence experimental
cloned [3-4], Illumina [5,7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  3. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  7. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275