miRBase entry: ath-MIR171b

Stem-loop ath-MIR171b


Accession
MI0000989
Description
Arabidopsis thaliana ath-MIR171b precursor miRNA

Literature search
32 open access papers mention ath-MIR171b
(129 sentences)

Sequence

202805 reads, 954.0 reads per million, 185 experiments
ugcaagguaacgcgAGAUAUUAGUGCGGUUCAAUCaaauagucguccucuuaacucauggagaacgguguuguucgaUUGAGCCGUGCCAAUAUCACGcgguaaaccaaaaauggca
.....(((..((((.((((((.(((((((((((((.(((((((((.((((........)))).))))..))))).))))))))))))).)))))).))))....)))..........

Structure
-----ugcaa   --aa    A      A             a     --    c    uaa 
          ggu    cgcg GAUAUU GUGCGGUUCAAUC aauag  ucgu cucu   c
          |||    |||| |||||| ||||||||||||| |||||  |||| ||||    
          cca    gcGC CUAUAA CGUGCCGAGUUag uuguu  ggca gagg   u
acgguaaaaa   aaug    A      C             c     gu    a    uac 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. Its expression in Arabidopsis was confirmed by cloning and Northern blot [2,3]. The mature sequence reported in [3] is offset by 4 nts with respect to the sequence shown here.

Genome context
chr1: 3961348-3961464 [-]

Database links

Mature ath-miR171b-5p

Accession MIMAT0031899
Description Arabidopsis thaliana ath-miR171b-5p mature miRNA
Sequence 15 - AGAUAUUAGUGCGGUUCAAUC - 35
Evidence not_experimental

Mature ath-miR171b-3p

Accession MIMAT0000920
Description Arabidopsis thaliana ath-miR171b-3p mature miRNA
Sequence 78 - UUGAGCCGUGCCAAUAUCACG - 98
Evidence experimental
cloned [2,4], Northern [2-3], 5'RACE [4], 454 [5-6], MPSS [5]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 15345049
    Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets
    Wang XJ, Reyes JL, Chua NH, Gaasterland T
    Genome Biol (2004) 5:R65

  5. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799

  6. PubMed ID: 15258262
    Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
    "Sunkar R, Zhu JK"
    "Plant Cell (2004) 16:2001-2019