Stem-loop ath-MIR393a

Accession

MI0001003

Description

Arabidopsis thaliana ath-MIR393a precursor miRNA

Literature search

36 open access papers mention ath-MIR393a
(97 sentences)

Sequence

184299 reads, 1037.0 reads per million, 185 experiments

agaggaaggaUCCAAAGGGAUCGCAUUGAUCCUaauuaaggugaauucuccccauauuuucuuuauaauuggcaaauaaaucacaaaaauuugcuugguuuuggAUCAUGCUAUCUCUUUGGAUUcauccuuc
.(((((.((((((((((((((.((((.(((((.(((((((((((.......(((.(((........))))))........)))).........)))))))..))))))))).)))))))))))))).))))).

Structure

a     a              C    U     -U       ---------    -auucucc   u   uuc 
 gagga ggaUCCAAAGGGAU GCAU GAUCC  aauuaag         guga        cca auu   u
 ||||| |||||||||||||| |||| |||||  |||||||         ||||        ||| |||    
 uuccu cUUAGGUUUCUCUA CGUA CUAgg  uugguuc         cacu        ggu uaa   u
c     a              U    -     uu       guuuaaaaa    aaauaaac   -   uau 

Annotation confidence High

Comments

This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1].

Genome context

chr2: 16652101-16652233 [+]

Mature ath-miR393a-5p

• Accession: MIMAT0000934
• Description: Arabidopsis thaliana ath-miR393a-5p mature miRNA
• Sequence: 11 - UCCAAAGGGAUCGCAUUGAUCCU - 33
• Evidence: experimental ; 5'RACE [1], Northern [1,3], PCR [1], cloned [2], 454 [4], MPSS [4-5]

Mature ath-miR393a-3p

• Accession: MIMAT0031905
• Description: Arabidopsis thaliana ath-miR393a-3p mature miRNA
• Sequence: 105 - AUCAUGCUAUCUCUUUGGAUU - 125
• Evidence: not_experimental

References

1. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


2. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


3. PubMed ID: 15345049
   Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets
   Wang XJ, Reyes JL, Chua NH, Gaasterland T
   Genome Biol (2004) 5:R65


4. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


5. PubMed ID: 15258262
   Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
   "Sunkar R, Zhu JK"
   "Plant Cell (2004) 16:2001-2019