Stem-loop ath-MIR396a

Accession

MI0001013

Description

Arabidopsis thaliana ath-MIR396a precursor miRNA

Literature search

29 open access papers mention ath-MIR396a
(269 sentences)

Sequence

cucuguauucUUCCACAGCUUUCUUGAACUGcaaaacuucuucagauuuuuuuuuuuuucuuuugauaucucuuacgcauaaaauagugauuuucuucauaucucugcucgauugauuugcgGUUCAAUAAAGCUGUGGGAAGauacagac
.((((((((.((((((((((((.((((((((((((.(.((..((((............((....))....................((((......))))...))))...))..).)))))))))))).)))))))))))).)))))))).

Structure

c        c            C            a -u  -uu    uuuuuuuuuuuuucuuuugauaucucuuacgcauaaaaua    uu 
 ucuguauu UUCCACAGCUUU UUGAACUGcaaa c  uc   caga                                        guga  u
 |||||||| |||||||||||| |||||||||||| |  ||   ||||                                        ||||   
 agacauaG AGGGUGUCGAAA AACUUGgcguuu g  ag   gucu                                        uacu  u
c        A            U            a uu  cuc    -------------------------------------cua    uc 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1].

Genome context

chr2: 4142323-4142473 [-]

Mature ath-miR396a-5p

• Accession: MIMAT0000944
• Description: Arabidopsis thaliana ath-miR396a-5p mature miRNA
• Sequence: 11 - UUCCACAGCUUUCUUGAACUG - 31
• Evidence: experimental ; 5'RACE [1-2], Northern [1], PCR [1], 454 [3], MPSS [3]

Mature ath-miR396a-3p

• Accession: MIMAT0031908
• Description: Arabidopsis thaliana ath-miR396a-3p mature miRNA
• Sequence: 123 - GUUCAAUAAAGCUGUGGGAAG - 143
• Evidence: experimental ; Illumina [5]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


5. PubMed ID: 24119003
   Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots
   Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutiérrez RA
   BMC Genomics (2013) 14:701