Stem-loop ath-MIR396b

Accession

MI0001014

Description

Arabidopsis thaliana ath-MIR396b precursor miRNA

Literature search

26 open access papers mention ath-MIR396b
(271 sentences)

Sequence

ggucauacuuUUCCACAGCUUUCUUGAACUUucuuuuucauuuccauuguuuuuuucuuaaacaaaaguaagaagaaaaaaaacuuuaagauuaagcauuuuggaaGCUCAAGAAAGCUGUGGGAAAacaugaca
.(((((..(((((((((((((((((((.(((((((..((..........(((((((((((........)))))))))))..........))..))).......)))).)))))))))))))))))))..))))).

Structure

g     ac                   A    -------   uu  auuuccauug           aac 
 gucau  uuUUCCACAGCUUUCUUGA CUUu       cuu  uc          uuuuuuucuua   a
 |||||  ||||||||||||||||||| ||||       |||  ||          |||||||||||    
 cagua  AAAGGGUGUCGAAAGAACU Gaag       gaa  ag          aaaagaagaau   a
a     ca                   C    guuuuac   uu  aauuucaaaa           gaa 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1]. The mature sequence reported in [2] is offset by 1 nt with respect to the sequence shown here.

Genome context

chr5: 13611798-13611932 [+]

Mature ath-miR396b-5p

• Accession: MIMAT0000945
• Description: Arabidopsis thaliana ath-miR396b-5p mature miRNA
• Sequence: 11 - UUCCACAGCUUUCUUGAACUU - 31
• Evidence: experimental ; 5'RACE [1], Northern [1-2], PCR [1], 454 [3], MPSS [3]

Mature ath-miR396b-3p

• Accession: MIMAT0031909
• Description: Arabidopsis thaliana ath-miR396b-3p mature miRNA
• Sequence: 107 - GCUCAAGAAAGCUGUGGGAAA - 127
• Evidence: not_experimental

References

1. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


2. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


3. PubMed ID: 15345049
   Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets
   Wang XJ, Reyes JL, Chua NH, Gaasterland T
   Genome Biol (2004) 5:R65


4. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799