Stem-loop ath-MIR408

Accession

MI0001080

Description

Arabidopsis thaliana ath-MIR408 precursor miRNA

Literature search

24 open access papers mention ath-MIR408
(70 sentences)

Sequence

aagguuagauugguauugcaaugaaagaagacaaagcgguaaugagagagagACAGGGAACAAGCAGAGCAUGgauugaguuuacuaaaacauuaaacgacucuguuuugucucuacccAUGCACUGCCUCUUCCCUGGCucccucuuuuuuucucuauauuucucucucuccuuucauuucacagcuuucaauggaauuuuauugcuacugcuaacg
...(((((...((((..(((((((((......(((((.((((((((((((((((((((((...((((.((((((...(((...((.((((((...........)))))))))))...)))))).))))...)))))))..........................))))))))...)))))..)).)))))........))))))))))))).))))).

Structure

aag     auu    uu         --gaagac     g  --     ---        --------------------------       CAA    A      auu   uuu  u      uuaa 
   guuag   ggua  gcaaugaaa        aaagc gu  aauga   gagagagA                          CAGGGAA   GCAG GCAUGg   gag   ac aaaaca    a
   |||||   ||||  |||||||||        ||||| ||  |||||   ||||||||                          |||||||   |||| ||||||   |||   || ||||||    c
   caauc   ucau  cguuauuuu        uuucg ca  uuacu   cucucucu                          GUCCCUU   CGUC CGUAcc   cuc   ug uuuugu    g
--g     --g    --         aagguaac     a  cu     uuc        cuuuauaucucuuuuuuucucccuCG       CUC    A      cau   ---  -      cuca 

Annotation confidence Not enough data

Genome context

chr2: 19319814-19320031 [+]

Mature ath-miR408-3p

• Accession: MIMAT0001011
• Description: Arabidopsis thaliana ath-miR408-3p mature miRNA
• Sequence: 120 - AUGCACUGCCUCUUCCCUGGC - 140
• Evidence: experimental ; cloned [1], Northern [1], 454 [2-3], MPSS [2], Illumina [4]

Mature ath-miR408-5p

• Accession: MIMAT0031915
• Description: Arabidopsis thaliana ath-miR408-5p mature miRNA
• Sequence: 53 - ACAGGGAACAAGCAGAGCAUG - 73
• Evidence: experimental ; Illumina [5]

References

1. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


2. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


3. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


4. PubMed ID: 15258262
   Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
   "Sunkar R, Zhu JK"
   "Plant Cell (2004) 16:2001-2019


5. PubMed ID: 24119003
   Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots
   Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutiérrez RA
   BMC Genomics (2013) 14:701