Stem-loop mmu-mir-370

Accession

MI0001165

Symbol

MGI: Mir370

Description

Mus musculus mmu-mir-370 precursor miRNA mir-370

Gene
family

RF00740; mir-370

Literature search

35 open access papers mention mmu-mir-370
(314 sentences)

Sequence

42341 reads, 148 reads per million, 65 experiments

agacggagagacCAGGUCACGUCUCUGCAGUUacacagcucaugaguGCCUGCUGGGGUGGAACCUGGUuugucugucu
(((((((.(((((((((..((((((.((((.(((.((.....)).))).)))).))))))..))))))))).)))))))

Structure

       g         CA      U    U   a  g 
agacgga agacCAGGU  CGUCUC GCAG Uac ca c
||||||| |||||||||  |||||| |||| ||| || u
ucugucu uuUGGUCCA  GUGGGG CGUC Gug gu c
       g         AG      U    C   a  a 

Annotation confidence Medium

Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr12: 109618258-109618336 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from mmu-mir-370

Mature mmu-miR-370-5p

• Accession: MIMAT0017174
• Description: Mus musculus mmu-miR-370-5p mature miRNA
• Sequence: 13 - CAGGUCACGUCUCUGCAGUU - 32
• Evidence: experimental ; 454 [5], Illumina [6]

Mature mmu-miR-370-3p

• Accession: MIMAT0001095
• Description: Mus musculus mmu-miR-370-3p mature miRNA
• Sequence: 48 - GCCUGCUGGGGUGGAACCUGGU - 69
• Evidence: experimental ; PCR [1], cloned [2-3], Illumina [4,6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275


5. PubMed ID: 15310658
   A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
   "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
   "Genome Res (2004) 14:1741-1748


6. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267