miRBase entry: ptc-MIR160b

Stem-loop ptc-MIR160b


Accession
MI0002202
Description
Populus trichocarpa ptc-MIR160b precursor miRNA

Literature search
6 open access papers mention ptc-MIR160b
(22 sentences)

Sequence


auauuauaugUGCCUGGCUCCCUGUAUGCCAuuugcagagcccaacggauccucgauggccuccguggaugGCGUAUGAGGAGCCAUGCAUAuucgca
.......((((((.(((((((.((((((((((((((.(((.(((.(((....))).))).))).)))))))))))))).))))))).)))))).....

Structure
auauuau      C       C              a   c   a   a 
       augUGC UGGCUCC UGUAUGCCAuuugc gag cca cgg u
       |||||| ||||||| |||||||||||||| ||| ||| |||  
       uAUACG ACCGAGG GUAUGCGguaggug cuc ggu gcu c
--acgcu      U       A              c   c   a   c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
CM000344.2: 2253371-2253468 [-]

Database links

Mature ptc-miR160b-5p

Accession MIMAT0001908
Description Populus trichocarpa ptc-miR160b-5p mature miRNA
Sequence 11 - UGCCUGGCUCCCUGUAUGCCA - 31
Evidence experimental
cloned [1], miRNAseq [4]

Mature ptc-miR160b-3p

Accession MIMAT0022890
Description Populus trichocarpa ptc-miR160b-3p mature miRNA
Sequence 72 - GCGUAUGAGGAGCCAUGCAUA - 92
Evidence experimental
miRNAseq [4]

References

  1. Conservation and divergence of microRNA families in plants
    "Dezulian T, Palatnik JF, Huson DH, Weigel D"
    Genome Biol. (2005) 6:P13

  2. PubMed ID: 16973872
    The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)
    "Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm"
    "Science (2006) 313:1596-1604

  3. PubMed ID: 15994906
    Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis
    "Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL"
    "Plant Cell (2005) 17:2186-2203

  4. PubMed ID: 22442676
    Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets
    Puzey JR, Karger A, Axtell M, Kramer EM
    PLoS One (2012) 7:e33034