Stem-loop ath-MIR779

Accession

MI0005109

Description

Arabidopsis thaliana ath-MIR779 precursor miRNA

Literature search

2 open access papers mention ath-MIR779
(13 sentences)

Sequence

aaugagaguaauauaguugaaucuucgaaaguauuucaagaagucagcugagcuuucucgucaucacuuauuaguaaauauagucucuauauuuuugaugagugaUGAUUGGAAAUUUCGUUGACUcauuacucuugaugaUUCUGCUAUGUUGCUGCUCAUu
(((((((((((((((((.(((((.((((.((((.....(..(((((((.(((.(((((.(((((((((((((((.((((((((...))))))))))))))))))))))).))))).))))))))))..))))).)))).))))).))))))))))).))))))

Structure

      -           u     u    a    uuuca ga       u   c     c               u        u 
aaugag aguaauauagu gaauc ucga agua     a  agucagc gag uuucu gucaucacuuauuag aaauauag  
|||||| ||||||||||| ||||| |||| ||||     |  ||||||| ||| ||||| ||||||||||||||| |||||||| c
uUACUC UCGUUGUAUCG CUUag aguu ucau     u  UCAGUUG CUU AAAGG UAGUagugaguaguu uuuauauc  
      G           U     u    c    ----- ac       -   U     U               -        u 

Annotation confidence Not enough data

Genome context

chr2: 9560761-9560923 [+]

Mature ath-miR779.2

• Accession: MIMAT0004329
• Description: Arabidopsis thaliana ath-miR779.2 mature miRNA
• Sequence: 106 - UGAUUGGAAAUUUCGUUGACU - 126
• Evidence: experimental ; 454 [3]

Mature ath-miR779.1

• Accession: MIMAT0003938
• Description: Arabidopsis thaliana ath-miR779.1 mature miRNA
• Sequence: 142 - UUCUGCUAUGUUGCUGCUCAU - 162
• Evidence: experimental ; MPSS [1], Northern [1], 454 [2-3], cloned [2]

References

1. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


2. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


3. PubMed ID: 17299599
   High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes
   Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC
   PLoS One (2007) 2:e219