Stem-loop ath-MIR780

Accession

MI0005110

Description

Arabidopsis thaliana ath-MIR780 precursor miRNA

Literature search

3 open access papers mention ath-MIR780
(6 sentences)

Sequence

caagauaucagauauuucacgaagauaucugcauaacagcuacgaggaaauugugauuuuaucguuucacaaacaucaacagcuccauggaucguuauggacggauaaaucacaaucacuauccuuuuUCUAGCAGCUGUUGAGCAGGUUUCUUCGUGAAUAUCUGGCAUuuug
((((((.(((((((((.((((((((.((((((.((((((((.(.(((((((((((((((.(((..((((..((((((..((......))))).))).))))..)))))))))))))..........))))).).)))))))).)))))).))))))))))))))))).))))))

Structure

      a         u        u      a        a g     ----------          u   gu    ca   -   aa  gc 
caagau ucagauauu cacgaaga aucugc uaacagcu c aggaa          auugugauuu auc  uuca  aac auc  ca  u
|||||| ||||||||| |||||||| |||||| |||||||| | |||||          |||||||||| |||  ||||  ||| |||  ||   
guuuUA GGUCUAUAA GUGCUUCU UGGACG GUUGUCGA G UCUuu          uaacacuaaa uag  aggu  uug uag  gu  c
      C         -        U      A        C A     uuccuaucac          -   gc    -a   c   --  ac 

Annotation confidence Not enough data

Comments

Fahlgren et al [2] identify two mature products from the same arm of the hairpin precursor, named here miR780.1 and miR780.2. miR780.2 corresponds to the sequence reported by Lu et al [1].

Genome context

chr4: 8504141-8504314 [-]

Mature ath-miR780.1

• Accession: MIMAT0004218
• Description: Arabidopsis thaliana ath-miR780.1 mature miRNA
• Sequence: 129 - UCUAGCAGCUGUUGAGCAGGU - 149
• Evidence: experimental ; 454 [2], cloned [2], Illumina [3]

Mature ath-miR780.2

• Accession: MIMAT0003939
• Description: Arabidopsis thaliana ath-miR780.2 mature miRNA
• Sequence: 150 - UUCUUCGUGAAUAUCUGGCAU - 170
• Evidence: experimental ; MPSS [1], Northern [1], 454 [2], cloned [2]

References

1. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


2. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


3. PubMed ID: 17299599
   High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes
   Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC
   PLoS One (2007) 2:e219