Stem-loop cre-MIR909

Accession

MI0005702

Description

Chlamydomonas reinhardtii cre-MIR909 precursor miRNA

Sequence

guucccgcacacguggcugaaggucgcggagcucuuugccgacacgguggccauguggucccgcagcuccuugccacacgggcAUGCAAACAUGACCCUGAAUGgcccugccugcggccugccccgcuccagggccuucugcugcugauggugcagaugcggcuggUGCUGGUCAAACCGGUGGUGGuggugcuggugcuguucgggcuccugcugcaccggcaguagcgccagcagcuggagcagguacagggcggccgccagcggcagcaccaccaccaccaccaccgguucgaccagcaccagccgcaccugcaccaccagcagcggauagaaggcuccggagcggggcaggcccaggcagggccaUUCAGGGUCAAGUUUGCAUGCccguguggcaagacgcugcgguaccacauggccaccgugucggcgaagggcuccgugaccuucagccacuugugcgggaac
(((((((((((.(((((((((((((((((((((((((((((((((((((((((((((((.(((((((..((((((((((((((((((((((.((((((((((((((((((((((.(((((((((((((((.((((((((((((((((.((((((((.(((((((((((((((((.(((((((((((((((((.(((((((((.((.(((((.(((((...(((......))).))))).)))))........(((....)))..))))))))))).))))))))))))))))).))))))))))))))))).)))))))).)))))))....))))))))).))))))))))))))))))))))))))))))))))))).))))))))))))))))))))))..))))))).))))))))))))))))))))))))))))))))))))))))))))))).)))))))))))

Structure

           c                                               c       uc                      A                      c               a         ----       a        a                 A                 c         u  -------------------g     u     acc   ag 
guucccgcaca guggcugaaggucgcggagcucuuugccgacacgguggccauguggu ccgcagc  cuugccacacgggcAUGCAAAC UGACCCUGAAUGgcccugccug ggccugccccgcucc gggccuucu    gcugcug uggugcag ugcggcuggUGCUGGUC AACCGGUGGUGGuggug uggugcugu cg                    gcucc gcugc   ggc  u
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||    ||||||| |||||||| ||||||||||||||||| ||||||||||||||||| ||||||||| ||                    ||||| |||||   |||   
caagggcgugu caccgacuuccagugccucgggaagcggcugugccaccgguacacca ggcgucg  gaacggugugccCGUACGUUUG ACUGGGACUUaccgggacggac ccggacggggcgagg cucggaaga    cgacgac accacguc acgccgaccacgaccag uuggccaccaccaccac accacgacg gc                    cgagg cgacg   ccg  a
           u                                               u       ca                      A                      -               c         uagg       c        c                 c                 c         -  gaccgccggcgggacaugga     u     --a   cg 

Annotation confidence Not enough data

Comments

Zhao et al. identify a pair of mature miRNA product from the 5' and 3' arms of the hairpin precursor, and named them miR909-5p and miR909-3p [1]. Molner et al. suggest that an alternative 5' product is the predominant one, named cre-miR909.1 here [2]. The Zhao et al. products are renamed miR909.2 and miR909.3 here. Molner et al. also show a number of offset and overlapping minor products originating from the same hairpin [2], but not catalogued here.

Genome context

Unknown

Mature cre-miR909.2

• Accession: MIMAT0004391
• Description: Chlamydomonas reinhardtii cre-miR909.2 mature miRNA
• Sequence: 84 - AUGCAAACAUGACCCUGAAUG - 104
• Evidence: experimental ; cloned [1-2]

Mature cre-miR909.1

• Accession: MIMAT0004967
• Description: Chlamydomonas reinhardtii cre-miR909.1 mature miRNA
• Sequence: 167 - UGCUGGUCAAACCGGUGGUGG - 187
• Evidence: experimental ; cloned [2]

Mature cre-miR909.3

• Accession: MIMAT0004392
• Description: Chlamydomonas reinhardtii cre-miR909.3 mature miRNA
• Sequence: 370 - UUCAGGGUCAAGUUUGCAUGC - 390
• Evidence: experimental ; cloned [1]

References

1. PubMed ID: 17470535
   A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii
   "Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y"
   "Genes Dev (2007) 21:1190-1203


2. PubMed ID: 17538623
   miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii
   "Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC"
   "Nature (2007) 447:1126-1129