Accession
MI0010464
Description
Bos taurus
bta-mir-29b-1 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Bta-mir-29b is a down-regulated microRNA that has been identified in various studies in relation to different biological processes. It has been found to be down-regulated in MG-LL and pMEC-LL, suggesting its involvement in lipid metabolism regulation [PMC4783934]. Bta-mir-29b has also been associated with glucose homeostasis and lipid metabolism in cattle [PMC9039951]. In addition, it has been identified as differentially expressed between bulls with different fertility levels [PMC9581129]. Bta-mir-29b has been shown to play a role in host-virus interactions, as it is upregulated upon infection with bovine viral diarrhea virus (BVDV) and can attenuate BVDV infection-related autophagy [PMC5885596]. Furthermore, bta-mir-29b has been found to promote triglyceride production and suppress apoptosis [PMC8027660]. It is also involved in myoblast development and cattle skeletal muscle myogenesis [PMC8847694]. Bta-mir-29b expression levels have been shown to be regulated during pregnancy and the estrous cycle, suggesting its involvement in reproductive processes [PMC5325256]. Additionally, bta-mir-29b expression has been found to be dysregulated in cows with metritis compared to healthy cows [PMC4941693][PMC7832875[PMC7832875]. Overall, bta-mir-29b is a versatile microRNA that plays a role in various biological processes.
Literature search
39 open access papers mention bta-mir-29b-1
(262 sentences)
(262 sentences)
Sequence
3136
reads,
359
reads per million, 74 experiments
cuucaggaagcugguuucauauggugguuuagauuuaaauagugauugucUAGCACCAUUUGAAAUCAGUGUUcuuggggg
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).
Structure
- - u gu uuaaa cuucaggaa gcugguuuca auggug uuagau u ||||||||| |||||||||| |||||| |||||| a gggguucUU UGACUAAAGU UACCAC GAUcug g g G U -- uuagu
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr4: 95727243-95727323 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-mir-29b-1
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature bta-miR-29b
| Accession | MIMAT0003828 |
| Description | Bos taurus bta-miR-29b mature miRNA |
| Sequence | 51 - UAGCACCAUUUGAAAUCAGUGUU - 73 |
| Evidence |
experimental
cloned [1,4], Array [2], qRT-PCR [2] |
References
|
