miRBase entry: bta-mir-29b-1

Stem-loop bta-mir-29b-1


Accession
MI0010464
Description
Bos taurus bta-mir-29b-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. bta-mir-29b is a microRNA (miRNA) that plays a role in lipid metabolism and has been implicated in various biological processes in cattle. It was found to be down-regulated in mammary gland and primary mammary epithelial cells of cows with low lipid synthesis, suggesting it does not regulate lipid synthesis under these conditions [PMC4783934]. Additionally, bta-mir-29b is differentially expressed in the liver of cattle with different residual feed intakes, indicating its involvement in glucose homeostasis and lipid metabolism [PMC9039951]. It has also been identified as differentially expressed between bulls with varying fertility levels [PMC9581129]. In the context of viral infections, bta-mir-29b expression was upregulated following BVDV infection and was shown to suppress viral replication and apoptosis by regulating caspase-7 and NAIF1 levels [PMC5885596]. Moreover, its upregulation led to the downregulation of autophagy-associated proteins ATG14 and ATG9A during BVDV infection [PMC5885596]. In commercial milk extracellular vesicles (EVs), bta-mir-29b does not exhibit a specific enrichment pattern, suggesting the presence of multiple EV subtypes [PMC5994974]. Lastly, it has been shown to promote triglyceride production while suppressing apoptosis [PMC5765104], indicating its multifaceted role in bovine biological processes.

Literature search
39 open access papers mention bta-mir-29b-1
(262 sentences)

Sequence

3136 reads, 36 reads per million, 74 experiments
cuucaggaagcugguuucauauggugguuuagauuuaaauagugauugucUAGCACCAUUUGAAAUCAGUGUUcuuggggg
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).

Structure
-         -          u      gu      uuaaa 
 cuucaggaa gcugguuuca auggug  uuagau     u
 ||||||||| |||||||||| ||||||  ||||||     a
 gggguucUU UGACUAAAGU UACCAC  GAUcug     g
g         G          U      --      uuagu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 95727243-95727323 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-mir-29b-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-miR-29b

Accession MIMAT0003828
Description Bos taurus bta-miR-29b mature miRNA
Sequence 51 - UAGCACCAUUUGAAAUCAGUGUU - 73
Evidence experimental
cloned [1,4], Array [2], qRT-PCR [2]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43

  2. PubMed ID: 19170227
    Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach
    "Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M"
    "Mol Reprod Dev (2009) 76:665-677

  3. PubMed ID: 19758457
    Characterization of bovine miRNAs by sequencing and bioinformatics analysis
    Jin W, Grant JR, Stothard P, Moore SS, Guan LL
    BMC Mol Biol (2009) 10:90

  4. PubMed ID: 18945293
    Annotation of 390 bovine miRNA genes by sequence similarity with other species
    "Strozzi F, Mazza R, Malinverni R, Williams JL"
    "Anim Genet (2009) 40:125