Stem-loop aae-mir-1174

Accession

MI0013471

Description

Aedes aegypti aae-mir-1174 precursor miRNA

Literature search

3 open access papers mention aae-mir-1174
(29 sentences)

Sequence

3 reads, 0 reads per million, 2 experiments

acuccaauucuggguauuuuagauccuuggcauaguuacgugauugaaugcacuguucuucuuugguuuacccaguaucgaacacgcgucaaucugUCAGAUCUACUUAAUACCCAUa
..........((((((((.((((((..(((((.........((((((.(((..(((((....((((.....))))....))))).))))))))))))))))))))...))))))))..

Structure

acuccaauuc        --u      cu     uaguuacgu      a   ac     uucu    u 
          uggguauu   uagauc  uggca         gauuga ugc  uguuc    uugg u
          ||||||||   ||||||  |||||         |||||| |||  |||||    |||| u
          ACCCAUAA   AUCUAG  ACUgu         cuaacu gcg  acaag    gacc a
--------aU        UUC      --     ---------      -   -c     cuau    c 

Annotation confidence Low

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

supercont1.125: 1647825-1647942 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from aae-mir-1174

Mature aae-miR-1174

• Accession: MIMAT0014265
• Description: Aedes aegypti aae-miR-1174 mature miRNA
• Sequence: 97 - UCAGAUCUACUUAAUACCCAU - 117
• Evidence: experimental ; 454 [1], Illumina [2]

References

1. PubMed ID: 19961592
   Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs
   Li S, Mead EA, Liang S, Tu Z
   BMC Genomics (2009) 10:581


2. PubMed ID: 20167119
   Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus
   Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR
   BMC Genomics (2010) 11:119