Stem-loop gma-MIR4414a

Accession

MI0016583

Description

Glycine max gma-MIR4414a precursor miRNA

Literature search

1 open access papers mention gma-MIR4414a
(1 sentences)

Sequence

acugaaacucAGCUGCUGACUCGUUGGCUCgagaguucaccauuaagauagauugauguucggcacucacgccauguaauuaagguggugugcuucugaUCCAACGAUGCGGGAGCUGCauucagucg
((((((...(((((.(((..(((((((.(((.((((.(((((((........(((((....(((......))).....)))))))))))).)))).))).)))))))..))).)))))..))))))..

Structure

--      acu     G   AC       C   a    u       aagauaga     -guuc   ac 
  acugaa   cAGCU CUG  UCGUUGG UCg gagu caccauu        uugau     ggc  u
  ||||||   ||||| |||  ||||||| ||| |||| |||||||        |||||     |||   
  ugacuu   GUCGA GGC  AGCAACC agu uucg guggugg        aauua     ccg  c
gc      -aC     G   GU       U   c    u       --------     augua   ca 

Annotation confidence Not enough data

Genome context

chr20: 36756848-36756975 [+]

Mature gma-miR4414a-5p

• Accession: MIMAT0018342
• Description: Glycine max gma-miR4414a-5p mature miRNA
• Sequence: 11 - AGCUGCUGACUCGUUGGCUC - 30
• Evidence: experimental ; Illumina [1]

Mature gma-miR4414a-3p

• Accession: MIMAT0032112
• Description: Glycine max gma-miR4414a-3p mature miRNA
• Sequence: 100 - UCCAACGAUGCGGGAGCUGC - 119
• Evidence: experimental ; Illumina [2-3]

References

1. PubMed ID: 20122185
   Prediction of novel miRNAs and associated target genes in Glycine max
   Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
   BMC Bioinformatics (2010) 11:S14


2. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153


3. PubMed ID: 25747880
   Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean
   "Zhao M, Meyers BC, Cai C, Xu W, Ma J"
   "Plant Cell (2015) 27:546-562