Stem-loop gma-MIR4415a

Accession

MI0016584

Description

Glycine max gma-MIR4415a precursor miRNA

Sequence

uggcugcagcAAGUUGUGAUGAGAAUCAAUGgcaagcagugacaccaagaaaaaaaaaucccauuauaaacauuuuuuccccucaaucuucuucucauaguauaucauuaggcuaacugguguugaaggauauaaauccacaacugccaUUGAUUCUCAUCACAACAUGGuccagu
..((((.(.((.((((((((((((((((((((((......(((((((.(((((((.................)))))))..................((((.((....)).))))..)))))))...((((....)))).....)))))))))))))))))))))).)).).))))

Structure

ug    c g  A                      --------------agcagu       -------------------------------------a       aaauccc 
  gcug a cA GUUGUGAUGAGAAUCAAUGgca                    gacacca                                      gaaaaaa       a
  |||| | || ||||||||||||||||||||||                    |||||||                                      |||||||       u
  ugac u GU CAACACUACUCUUAGUUaccgu                    uuguggu                                      cuuuuuu       u
--    c G  A                      caacaccuaaauauaggaag       caaucggauuacuauaugauacucuucuucuaacuccc       acaaaua 

Annotation confidence Not enough data

Genome context

chr18: 56193529-56193704 [+]

Mature gma-miR4415a-5p

• Accession: MIMAT0018343
• Description: Glycine max gma-miR4415a-5p mature miRNA
• Sequence: 11 - AAGUUGUGAUGAGAAUCAAUG - 31
• Evidence: experimental ; Illumina [1-3]

Mature gma-miR4415a-3p

• Accession: MIMAT0020955
• Description: Glycine max gma-miR4415a-3p mature miRNA
• Sequence: 150 - UUGAUUCUCAUCACAACAUGG - 170
• Evidence: experimental ; Illumina [2]

References

1. PubMed ID: 20122185
   Prediction of novel miRNAs and associated target genes in Glycine max
   Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
   BMC Bioinformatics (2010) 11:S14


2. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


3. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553