Stem-loop bdi-MIR164a

Accession

MI0018118

Description

Brachypodium distachyon bdi-MIR164a precursor miRNA

Literature search

5 open access papers mention bdi-MIR164a
(21 sentences)

Sequence

940608 reads, 18203.0 reads per million, 19 experiments

gaguggacauaugaggcgaggcgcgcgaggUGGAGAAGCAGGGCACGUGCauucguuccagcucgccgccggugugccgcgccgcggccugggcgcgcgugucgcccgagcggccggccaugcgcgugugugugcaugcaugUGCCCUUCUUCUCCACCGCGCaagccucgccugcgaacgcgcgcgcacgcc
..(((..(.....(((((((((..(((.((((((((((.(((((((((((..........(((.((((((((.(((.((((((((.......))).))))).)))))).))))).))).((((((......))))))))))))))))).)))))))))).)))..)))))))))(((....))))..)))...

Structure

-ga   ga -----auaug         gc   a          C           ---------auucguucca   c     -   u   c     -   gg 
   gug  c          aggcgaggc  gcg ggUGGAGAAG AGGGCACGUGC                   gcu gccgc cgg gug cgcgc cgc  c
   |||  |          |||||||||  ||| |||||||||| |||||||||||                   ||| ||||| ||| ||| ||||| |||  c
   cac  g          uccgcuccg  CGC CCACCUCUUC UCCCGUguacg                   cgg cggcg gcc cgc gugcg gcg  u
ccg   gc cgcgcaagcg         aa   G          U           uacgugugugugcgcguac   c     a   -   u     c   gg 

Annotation confidence Medium

Genome context

2: 19949322-19949514 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from bdi-MIR164a

Mature bdi-miR164a-5p

• Accession: MIMAT0020693
• Description: Brachypodium distachyon bdi-miR164a-5p mature miRNA
• Sequence: 31 - UGGAGAAGCAGGGCACGUGC - 50
• Evidence: experimental ; Illumina [1,3]

Mature bdi-miR164a-3p

• Accession: MIMAT0027067
• Description: Brachypodium distachyon bdi-miR164a-3p mature miRNA
• Sequence: 143 - UGCCCUUCUUCUCCACCGCGC - 163
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 21371551
   Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs
   "Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G"
   "Genomics (2011) 97:282-293


2. PubMed ID: 19772667
   Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response
   Zhang J, Xu Y, Huan Q, Chong K
   BMC Genomics (2009) 10:449


3. PubMed ID: 23264558
   Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon
   "Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E"
   "Mol Plant (2013) 6:423-443