Stem-loop ptc-MIR6462b

Accession

MI0021981

Description

Populus trichocarpa ptc-MIR6462b precursor miRNA

Literature search

1 open access papers mention ptc-MIR6462b
(2 sentences)

Sequence

auggaugggaucagcgaggggcaaaaauggcauaagagagauguacagcgguugggaaggggaagagaaagaucgauaucuacuacccuuccuuuUCUCUUAUGCAUUUUUGUCCCucgccagucucgcccau
((((.((((((..((((((((((((((((.(((((((((((............((((((((..(((((.(......).))).)).)))))))))))))))))))))))))))))))))))..)))))).))))

Structure

    a      ca                g           uguacagcgguu        ga  -   a ga 
augg ugggau  gcgaggggcaaaaaug cauaagagaga            gggaaggg  ag aga a  u
|||| ||||||  |||||||||||||||| |||||||||||            ||||||||  || ||| |   
uacc gcucug  cgcuCCCUGUUUUUAC GUAUUCUCUuu            uccuuccc  uc ucu u  c
    c      ac                -           ------------        -a  a   a ag 

Annotation confidence Not enough data

Genome context

CM000341.2: 24270125-24270257 [+]

Clustered miRNAs

5 other miRNAs are < 10 kb from ptc-MIR6462b

Mature ptc-miR6462b

• Accession: MIMAT0025204
• Description: Populus trichocarpa ptc-miR6462b mature miRNA
• Sequence: 96 - UCUCUUAUGCAUUUUUGUCCC - 116
• Evidence: experimental ; miRNAseq [1], Illumina [2]

References

1. PubMed ID: 22442676
   Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets
   Puzey JR, Karger A, Axtell M, Kramer EM
   PLoS One (2012) 7:e33034


2. PubMed ID: 23570526
   Identification of drought-responsive and novel Populus trichocarpa microRNAs by high-throughput sequencing and their targets using degradome analysis
   Shuai P, Liang D, Zhang Z, Yin W, Xia X
   BMC Genomics (2013) 14:233