MIR10A is a microRNA implicated in the regulation of gene expression and has been observed to influence the metastatic potential of cervical cancer cells by targeting the tumor suppressor gene PTEN [PMC6398879]. Additionally, MIR10A has been reported to interact with the 5' untranslated regions (UTRs) of mRNAs, particularly those with a terminal oligopyrimidine (TOP) motif, which can lead to both repression and activation of translation, suggesting a complex role in post-transcriptional regulation [PMC1794424]. Research findings have also indicated an upregulation of MIR10A in certain contexts, while other microRNAs did not exhibit significant changes in expression levels [PMC6132736].
 
                            -----gauc   --c    uu        A    G     C          uaaggaa 
         ugu   uguc  cuguauaU CCCU UAGAU CGAAUUUGUG       u
         |||   ||||  |||||||| |||| ||||| ||||||||||        
         aca   acag  gauguAUA GGGG AUCUA GCUUAAACac       u
ucucgccuc   aau    uu        A    -     U          ugguguu 
            | Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0000253 | 
| Description | Homo sapiens hsa-miR-10a-5p mature miRNA | 
| Sequence | 22 - UACCCUGUAGAUCCGAAUUUGUG - 44 | 
| Evidence | experimental cloned [2-3] | 
| Database links |       | 
| Predicted targets |       | 
| Accession | MIMAT0004555 | 
| Description | Homo sapiens hsa-miR-10a-3p mature miRNA | 
| Sequence | 63 - CAAAUUCGUAUCUAGGGGAAUA - 84 | 
| Evidence | experimental cloned [2] | 
| Database links |       | 
| Predicted targets |       | 
| 
 |