miRBase entry: mmu-mir-20b

Stem-loop mmu-mir-20b


Accession
MI0003536
Symbol
MGI: Mir20b
Description
Mus musculus mmu-mir-20b precursor miRNA
Gene family
MIPF0000001; mir-17

Literature search
87 open access papers mention mmu-mir-20b
(163 sentences)

Sequence

14344 reads, 135 reads per million, 90 experiments
ccuaguagugcCAAAGUGCUCAUAGUGCAGGUAGuuuuuauaccacucuACUGCAGUGUGAGCACUUCUAGuacuccugg
.((((.(((((..(((((((((((.(((((.(((.............)))))))).)))))))))))...))))).))))

Structure
c    u     -CA           G     G   uuuuu 
 cuag agugc   AAGUGCUCAUA UGCAG UAG     a
 |||| |||||   ||||||||||| ||||| |||     u
 gguc ucauG   UUCACGAGUGU ACGUC Auc     a
-    c     AUC           G     -   ucacc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chrX: 52742113-52742192 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from mmu-mir-20b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-20b-5p

Accession MIMAT0003187
Description Mus musculus mmu-miR-20b-5p mature miRNA
Sequence 12 - CAAAGUGCUCAUAGUGCAGGUAG - 34
Evidence experimental
cloned [1,3-4], MPSS [2], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-20b-3p

Accession MIMAT0004788
Description Mus musculus mmu-miR-20b-3p mature miRNA
Sequence 50 - ACUGCAGUGUGAGCACUUCUAG - 71
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  6. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267